B6.129-Flt3^tm1Dgg/J

Stock number: 011112
Product name: FLT3-ITD
Research areas: Cancer Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Flt3-ITD homozygous knock-in mutant mice develop myeloproliferative disease exhibiting increased myeloid and monocytic cell populations and reduced B and T cell lymphoid cell numbers. This mutant mouse strain may be useful in studies of B cell development, hematopoiesis and myeloproliferative diseases such as chronic myelomonocytic leukemia and Chronic Familial Myelocytic Leukemia-Like Syndrome.

Detailed description

These mice carry the human W51 mutation, ITD, internal tandem duplication of amino acids 596 to 602, in the endogenous mouse Flt3 locus, which confers constitutive FLT3 signaling. Mice that are homozygous for the targeted mutation are viable and fertile. The Donating Investigator reports that BALB/c mice carrying this allele are not as viable as mutants on the C57BL/6 background. Although FLT protein levels are comparable to wildtype, increased phospho-Flt3 (p-FLT3) and phospho-Stat5 (pSTAT5) levels are detected by flow cytometric analysis of homozygous bone marrow and splenic cells. Homozygotes exhibit leukocytosis, monocytosis and progressive splenomegaly. Mature myeloid and monocytic populations in homozygotes are increased, with reduced B and T cell populations. B cell development is arrested at the pre-B stage. Heterozygotes have decreased liver size, hemoglobin levels, platelet counts and exhibit a milder maturing myeloid hyperplasia phenotype when compared to homozygotes.

Development

The human W51 mutation (ITD, internal tandem duplication of amino acids 596 to 602) was inserted in-frame into exon 14 and a floxed neo cassette inserted downstream of exon 15. The construct was electroporated into (129X1/SvJ x 129S1/Sv)F1-Kitl⁺ derived R1 embryonic stem (ES) cells. Correctly targeted ES cells were injected into recipient blastocysts. The donating investigator stated that the resulting chimeric animals were crossed to C57BL/6 mice, and then backcrossed to the same for 9 generations (see SNP note below). Upon arrival at The Jackson Laboratory, the mice were crossed to C57BL/6J at least once to establish the colony.

A 32 SNP (single nucleotide polymorphism) panel analysis, with 27 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. While the 27 markers throughout the genome suggested a C57BL/6 genetic background, all 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a C57BL/6N genetic background.

 

Allele

Symbol: Flt3^tm1Dgg
Name: targeted mutation 1, D Gilliland
MGI accession ID: MGI:3763385
Generation method: Targeted
Attributes: Humanized sequence
Synonyms: FLT3/ITD; Flt3^ITD
Marker symbol: Flt3
Marker name: FMS-like tyrosine kinase 3
Marker synonyms: CD135; FLK2; FLK-2; Flt-3; STK1; wmfl
Chromosome: 5
Strain of origin: (129X1/SvJ x 129S1/Sv)F1-Kitl⁺
Molecular note: The human W51 mutation which causes the duplication of amino acid 595 to 601 (REYEYDL; AGAGAATATGAATATGATCTC) was inserted in-frame into exon 14, replacing the endogenous single copy (RDYEYDL; AGGGACTATGAATATGACCTT). A loxP site flanked neomycin selection cassette was inserted into intron 15.