B6;CBA-Tg(P-taulacZ)8Mom/MomJ

Stock number: 006742
Product name: P-LacZ-Tg, line 8
Research areas: Developmental Biology Research, Neurobiology Research, Research Tools, Sensorineural Research

Description

The transgene in these mice is primarily expressed in olfactory sensory neurons that co-express class II olfactory receptors.

Detailed description

The Tg(P-taulacZ)8Mom transgene is expressed in approximately 10% of olfactory sensory neurons, which are also expected to co-express an endogenous olfactory receptor. This transgene is preferentially expressed in olfactory sensory neurons that co-express class II olfactory receptors, with a 100-fold lower expression found in class I expressing neurons. Immunohistochemistry shows expression in NCAM2 staining glomeruli, which are generally dorsally projecting, and a ventral subset of NQO1 staining glomeruli, which are generally ventrally projecting. Expression is absent in glomeruli in the dorsal-medial and anterior-dorsal olfacotry bulb giving an unlabeled butterfly-shaped pattern in a dorsal view. When mice co-express both this transgene and a YFP labelled null allele of Olfr545, a class I olfactory receptor, they label distinct regions; when mice co-express both this transgene and a GFP labelled null allele of Olfr160, a class II olfactory receptor, they label the same region.

Development

A 317 base pair regulatory sequence, P, excised from between the Olfr713 and Olfr714 genes was placed upstream of a taulacZ cassette and this construct was microinjected into the pronuclei of (CBA x C57BL/6J)F2 fertilized eggs. The founders were subsequently bred to C57BL/6J. The 317 base pair regulatory sequence is tccctgtgcagcagagtagctcattaacaactttttaatgaagtcacagatagtgactgctcattaataaatttattagtctgcagccccagagattaaagaaactgaaaacagaagtcagtgacaacagtgtttagccagagtagctgcatcagagtg aaaagagggaacttctcttggcagactctgaaacttttactgttggacctctagggtccttgcaggtcccagaaactgtaattctgaaaatagaaacctggggggactaagaacttgatgggatgaaggaaaaacagagccaaatgatcccaggcttg

Allele

Symbol: Tg(P-taulacZ)8Mom
Name: transgene insertion 8, Peter Mombaerts
MGI accession ID: MGI:3827014
Generation method: Transgenic
Attributes: Reporter
Synonyms: P-LacZ-Tg, line 8
Marker symbol: Tg(P-taulacZ)8Mom
Marker name: transgene insertion 8, Peter Mombaerts
Marker synonyms: P-LacZ-Tg, line 8
Chromosome: UN
Strain of origin: (CBA x C57BL/6J)F2
Expressed genes: lacZ,beta-galactosidase,E. coli
Site of expression: lacZ is expressed in olfactory sensory neurons.
Molecular note: A 317 nucleotide sequence from between Olfr713 and Olfr714, which has homology with the a sequence in the Olfr713 promoter, was placed upstream of a taulacZ cassette and this construct was microinjected into the pronuclei of (CBA x C57BL/6J)F2 fertilized eggs. Expression from this transgenic insertion is 2 to 3 times higher than the normal expression of an olfactory receptor gene, with expression found in as many as 10% of olfactory sensory neruons.