Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
Mutant= 96bp
Wild Type = 108bp
>chr9:22067839-22067946 108bp TTTGGGTCTACATCATGCC CATAGGATGAGTTTGAGGCT
Large deletion: Mutant sequence with junction in uppercase
agtgctggggagacaggcgtgcaccacctctcctgcatctgtaacgtttctaatgattgacacaaaggctgactacACtggtggcagtgagccctgctctgcctcttttttgatgcattagcctcaaactcatcctatggcagaggctgcctgtatc
This mutation is a 554 bp deletion of Chr9:22,067,901-22,068,454 (GRCm38/mm10)
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 80556 | TTT GGG TCT ACA TCA TGC C | Wild type Forward | A | |||
| 80557 | CAT AGG ATG AGT TTG AGG CT | Common | A | |||
| 80558 | ACG TTT CTA ATG ATT GAC ACA | Mutant Forward | A | |||
| 80559 | Fluorophore-1 | ATC ATG GTG GTT CAA GAG AG | Quencher-1 | WT Probe | ||
| 80560 | Fluorophore-2 | CTG ACT ACA CTG GTG GCA G | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 80556 | 0.40 uM |
| 80557 | 0.40 uM |
| 80558 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.