For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 118 bp
Wild Type = 137 bp
Sequence
Mutant Sequence (Large deletion; Junction in UPPER case):
ttatcagttatttttaaggtcacaacattttatgtaatttacttctgtgaagcaagagcattttgaatagtgttcacctgctttagatacttgtgtagcctcccagaattccacaagacagaactcatttcgtagtggagatagacctcgttcggtagcacagacagaattcatatggtagtataaatgctgatttgtttcctgaagtcagtctgatagttttcttactgtgttaaaaccctctttggatcctaagaatctgttaaCTggactcatcacctcagtcagtcaccttagtccggaactggcccaggctctctgtctcaaaagttcagcacccactgagaactccccttgcgggcagactcctgcaaactgaggtcatgagaaaagcgagtagcaagggcttctaaatgctcaaagctcatgtgaccagcacacctttctctgaaggccaacgc
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CTGAGGTGATGAGTCCAGCA and CTAAGAATCTGTTAACCCCA. This resulted in a 1,331 bp deletion of Chr4:128,591,258-128,592,588 (GRCm38/mm10) that removes exons ENSMUSE00001076587 through ENSMUSE00001043953
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 80501 | TGC TGA TTT GTT TCC TGA AG | Common | A | |||
| 80502 | GTG TGG TCC CCT CAA TGG | Wild type Reverse | A | |||
| 80503 | GTT CCG GAC TAA GGT GAC | Mutant Reverse | A | |||
| 80504 | Fluorophore-1 | ACA CTC AAG GTA ACA GTC CT | Quencher-1 | WT Probe | ||
| 80505 | Fluorophore-2 | CTG TTA ACT GGA CTC ATC ACC TCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 80501 | 0.40 uM |
| 80502 | 0.40 uM |
| 80503 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.