For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 60 bp
Wild Type = 108 bp
>chr7:6290409+6290516 108bp CTCTGCTCTTTTGGTCTGTT CGAGTCTATTCAACCAGGAG
Sequence
Wt Sequence (deletions in lower case):
TTTAATACCTCTGCTCTTTTGGTCTGTTAACCCCTGtcatgatatgtcgcctgtagtcaccatttttctccagccctgcagaaagcacttttgaagctcctggttgaatagactcgtaattttctttcatttcaggcaccagtgacttttggggacttagccatctacttctcccaggaggaatgggaatggctgagtcccatgcagaaagatttgtacgaggatgtcatgttggagaactatcacaatctagtctcagttggtaaggtgtcgcggcccacacttccctgtCTCAGTTGGTAAGGTTTCATGGCCCACACTTCCCACCCCA
This mutation is a 255 bp deletion of Chr7:6,290,437-6,290,691 (GRCm38/mm10) that removes exon ENSMUSE00001300926.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79922 | CTC TGC TCT TTT GGT CTG TT | Common | A | |||
| 79923 | CGA GTC TAT TCA ACC AGG AG | Wild type Reverse | A | |||
| 79924 | GAA GTG TGG GCC ATG AAA | Mutant Reverse | A | |||
| 79925 | Fluorophore-1 | TGA TAT GTC GCC TGT AGT CAC C | Quencher-1 | WT Probe | ||
| 79926 | Fluorophore-2 | AAC CCC TGC TCA GTT GGT AAG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79922 | 0.40 uM |
| 79923 | 0.40 uM |
| 79924 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.