For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 96 bp
Wild Type = 104 bp
Sequence
Large deletion: Mutant sequence with junction in lowercase
CCCTAAATAAGTGAAGAGGGTGTGTAGTGGTTATCCAGCACCAGACCCTTTTTAGGCAAGGAAAACAAGACCCGTGGTCACTCCAAGGTCACACAACAGGAACACTGTAGAGTGAGGGTGCCAGCCCAGGGCACTTGTTCCCACTCCAGGGCTCTCCTGTCTGCCTCTGTTGTTTTATCTTGGGTCAGCTGTCATCTTGAGTTCTTTCAATGTCTGGTGGCCAGATGACCTGTtaTTCTGCTTAGACCTATCCGAGCACAGCGTCCTTAGGGCTGACTCTGGGTTGACTTCCCCCTCCAGCTGATCCTGCCTCAGGGTAAAGAGCCAGCTGCTACTTGGTGCCATATAGTCTCGGTTGGTGAGGGCTTGCATGCCCAGAATTGGGGTGCATC
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATAGGTCTAAGCAGAATCTG and GCAGAGTTAAGTTTGTAAAC. This resulted in a 438 bp deletion of Chr16:21,945,797-21,946,234 (GRCm38/mm10) that removes exon ENSMUSE00000131334.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79844 | ATG TGT TCC TGC TCT TTT GC | Wild type Forward | A | |||
| 79845 | GAA ACC CAG TTG GAG AGA G | Wild type Reverse | A | |||
| 79846 | CAG CTG TCA TCT TGA GTT CT | Mutant Forward | A | |||
| 79847 | CAG AGT CAG CCC TAA GGA | Mutant Reverse | A | |||
| 79848 | Fluorophore-1 | CTG CTT GTA GAG GTA GGC | Quencher-1 | WT Probe | ||
| 79849 | Fluorophore-2 | CCA GAT GAC CTG TTA TTC TGC TTA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79844 | 0.40 uM |
| 79845 | 0.40 uM |
| 79846 | 0.40 uM |
| 79847 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.