For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 97 bp
Wild Type = 110 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase:
tgcagtgtcaatcaaattcaaagacttgtgattacatactaacaactaccacccgctactccaaacttcctgtctcacccatgtttctcccagctccctccaaagaaccaaaccccaaatggtacgacccagtcatgaatggtttaaaatacagatctcgtcatttccacaCTgtggtcttggtgttctgttctggagaaagctccttgaacccctgtctttagcacaggaatcttccatcatgcataatgcagac
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATTAAATTCAGGGTAAACTG and CGTCATTTCCACACTTTCCA. This resulted in a 568 bp deletion of Chr11:65,815,665-65,816,232 (GRCm38/mm10) that removes exon ENSMUSE00000112310.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79786 | AAT GGT ACG ACC CAG TCA TG | Common | A | |||
| 79787 | GGG CTG TGG TTA GTA CGG | Wild type Reverse | A | |||
| 79788 | GGG TTC AAG GAG CTT TCT C | Mutant Reverse | A | |||
| 79789 | Fluorophore-1 | CAG GGG CAT TAT ACT GTT TCA | Quencher-1 | WT Probe | ||
| 79790 | Fluorophore-2 | CAC ACT GTG GTC TTG GTG TTC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79786 | 0.40 uM |
| 79787 | 0.40 uM |
| 79788 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.