For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 111 bp
Wild Type = 127 bp
Sequence
Wt Sequence (deletions in UPPER case):
agccaggacgaccttgctgatcctcctgcctccacctcctgtgttgggatcgcaggtgtgctccagcatggtttacagggcactggcaatggaactcatagcttgcgctctaggcgagcacactgccaacggacccatattcccagggcccttttctggatttagaatgaaagtccagcatatagtcagtcctctcaggggagccccccagtccacactccaggccctccttgcccatgtgaccagagtccccatcttctagtcacattgactactgactgcactgaacggatgagcctcacCATTTTCTTCCAGAAGATTCTGTGACTCTCGCTCGGGCTGGGCCTCCACAGGTAGACACTGGTGACTGAAGGACTCCTGCGTGGCTCCGGGTGGTACCATCTTCTGAGGAAGTACTTCGGGACTTGTGGCAATctaacaaccacaactacaaccaatcagcaaaattacagatggggatgggaaagaatccattagagtccattagactgccacctgtcccctggtccaacactcaccttgtgtctacaatgagccaattaagcagcagtttaagtatggtttattcctactgggaaaagacttccatgagacatacccacatgcaaatacttcgtcttgaacttcatgttacatggg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCATCTGTAATTTTGCTGAT and CATATAGTCAGTCCTCTCAG. This resulted in a 284 bp deletion of Chr5:145,207,538-145,207,821 (GRCm38/mm10) that removes exon ENSMUSE00000190608.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79781 | GGT ACC ATC TTC TGA GGA A | Wild type Forward | A | |||
| 79782 | GAC AGG TGG CAG TCT AAT G | Common | A | |||
| 79783 | CAA CGG ACC CAT ATT CCC | Mutant Forward | A | |||
| 79784 | Fluorophore-1 | CTT GTG GCA ATC TAA CAA CC | Quencher-1 | WT Probe | ||
| 79785 | Fluorophore-2 | AGC ATA TAG TCA GAT GGG GAT GGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79781 | 0.40 uM |
| 79782 | 0.40 uM |
| 79783 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.