For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 90 bp
Wild Type = 114 bp
Sequence
Large Deletion: Mutant Sequence with junction in uppercase:
aggactgaggcaagaggcccgactgagcccaggacctcagcagtacagcagcacctcaccttaaacagaggtgggatggaaatccaccccatacatgctatccctgggtgccatcggtggctccgtggcttctctgcgtctgagccctgcactctcatgcagcacacgcccacgaggcacctgtgtttgcccctggaatgaccgtgatgctttcttgttggACttagagatcctactagcaggcacagatataccaagaaccatcccttttaggggttgggtgccctttggcccaatgagataactctctggtctcttggtttttgttattgttgtattgttttcttttaaaaaaatgatttatgtttattttatgtccattagtattttgccagcatgtatgtctgagggtcacatctcctggaactggggctacacac
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GATGCTTTCTTGTTGGACAG and CTAGTAGGATCTCTAAGCAT. This resulted in a 3,015 bp deletion of Chr12:110,863,842-110,866,856 (GRCm38/mm10) that removes exon ENSMUSE00000431719 through ENSMUSE00000116259.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79072 | GCT GTG TAC AAG GAG TTT GA | Wild type Forward | A | |||
| 79073 | CTC ATC GTT GCT GAT CTC C | Wild type Reverse | A | |||
| 79074 | TGT GTT TGC CCC TGG AAT | Mutant Forward | A | |||
| 79075 | AAA AGG GAT GGT TCT TGG TA | Mutant Reverse | A | |||
| 79076 | Fluorophore-1 | TGA AGA GAA TGT GTC AGG ATT AC | Quencher-1 | WT Probe | ||
| 79077 | Fluorophore-2 | AGG ATC TCT AAG TCC AAC AAG AAA GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79072 | 0.40 uM |
| 79073 | 0.40 uM |
| 79074 | 0.40 uM |
| 79075 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.