For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 104 bp
Wild Type = 129 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase:
ctgacctttacaacaatgaatcaagagcccaggtgcagtcctttgaaatgttaaatacttaattcaccccatatcttgaaaattcctatgctttgagatttggttgtatttttaagtcttcatgctgaatttataaccgacatatcctttctggccctatttacgcttacattttacagagtcctaggctctgcatgacagacacccagGGagaagagggaagaaaggaggaaggaaggaggaaaacactgtaagtattcctttctagtctgggtttcttgaaattaatgaatgtatttttctatagatgtacagaacaaaatatttgttcatctttactttaatttaaaaaaacaaacatccatcaaaccaacgaagactccccactgtcagggaaaacatacgttactttcaatactcaagaagggaatttcagagcagatgcataagcctgaagagactacagcttcattgtactttcattccttatcaaacgcaatactaaagaataaccacccatggaaggagttacagagacaaagtttggagctgagacgaaaggatggaccatgtagagactgccatatccagggtacccca
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CAGGATTTAGAGCAACACCC and CTATTTAGTGATGTGAGGAG. This resulted in a 7,024 bp deletion of Chr13:76,001,340-76,008,363 (GRCm38/mm10) that removes exons ENSMUSE00000338726 through ENSMUSE00000413025.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79051 | ATA ATC CTT CTC CTG TTG CC | Wild type Forward | A | |||
| 79052 | TCC CAA ACA CTT TAA GGT CA | Wild type Reverse | A | |||
| 79053 | GAG TCC TAG GCT CTG CAT | Mutant Forward | A | |||
| 79054 | TCA AGA AAC CCA GAC TAG AA | Mutant Reverse | A | |||
| 79055 | Fluorophore-1 | TTG TCC ATT GAA ATC CTG GA | Quencher-1 | WT Probe | ||
| 79056 | Fluorophore-2 | AGA CAC CCA GGG AGA AGA GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79051 | 0.40 uM |
| 79052 | 0.40 uM |
| 79053 | 0.40 uM |
| 79054 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.