For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 91 bp
Wild Type = 100 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase:
gacccccaaccatataaattttccttgttgctacttcataactgtaatttggctatctactatgtggcccccacaggggtcacaacccacaggttgagaaccactgctctacggcaaacacagcgtcagtctctgcagctgtgagccactgcagagattctaaggcagcagcactcctatacaccatgtagggtcatcacaagcaacaaaacctcaagactgttccaaccttgctgttaaaacttcacaagcgcctctgaaggaaaccactccaaaggccgatGTagtctccctgaggagccagtgttggaggaaaaatcaggaaataacaggaagattggcatcaatactgaaagtaaagctttgacctgacttttgtctagtatgctcattccttaaacaaatttaatttaaaactgtaataaacttctatgacattgcccaaagtgaatctgaccataaggccatggactgtggggc
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCTCAGGGAGACTACAACGG and CCAAGACCCTGCTAGAACAT. This resulted in a 6,240 bp deletion of Chr1:38,991,095-38,997,334 (GRCm38/mm10) that removes exon ENSMUSE00000226043 through ENSMUSE00000335358.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79042 | ACC TCT CAC AAT ACC CTC AG | Wild type Forward | A | |||
| 79043 | GGA TAT CAA GGC ACA GTT CA | Wild type Reverse | A | |||
| 79044 | CTC TGA AGG AAA CCA CTC C | Mutant Forward | A | |||
| 79045 | GAT GCC AAT CTT CCT GTT ATT | Mutant Reverse | A | |||
| 79046 | Fluorophore-1 | CGT CTA TGG TCA GGT TCA TG | Quencher-1 | WT Probe | ||
| 79047 | Fluorophore-2 | AGG CCG ATG TAG TCT CCC TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79042 | 0.40 uM |
| 79043 | 0.40 uM |
| 79044 | 0.40 uM |
| 79045 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.