For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 106 bp
Wild Type = 114 bp
Sequence
Mutant sequence with junction in uppercase:
ctcatgtaacagaggctaacttggaatttactatttagttgaggttgaccttgaactcttggtcctcctacctccctgtgcttggaattagagacacttgtgaccacacccagctgctgattatctcaaagcaaagggtaaatgctagacttaaaagggctcctacgttctggtggttgaatatgtccaggtgaacaaagtaccaatgagacatcactgcaactccaTCtgggggaggggggggattttcaacagtattcagatagttattggctgctaaatgaaataaataagtcatttccctttgtcccagattctgtaacctcttcttcactgtagctaatctaatgcatgagagatcatacaatggcagccttgcttggcgtgctctatcaaagctcttctgagtctcactgctgccgtgtgccacaaaagaccactgcaaggtcacagagtccactagaaatcctaaaaaggtcagagtcagtctccaagaca
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GAGATGTCAGTCATACCTGG and CATCACTGCAACTCCATAGA. This resulted in a 4,544 bp deletion of Chr3:105,924,331-105,928,874 (GRCm38/mm10) that removes exon ENSMUSE00001218629 through ENSMUSE00000636872.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79036 | TTT GCT ACC AAA CCT GAC AA | Wild type Forward | A | |||
| 79037 | TGT ACA TAC ACA CCA CAG AG | Wild type Reverse | A | |||
| 79038 | GTG GTT GAA TAT GTC CAG GT | Mutant Forward | A | |||
| 79039 | AGC AGC CAA TAA CTA TCT GA | Mutant Reverse | A | |||
| 79040 | Fluorophore-1 | ACT CCT GAA AGT TGT CCT CT | Quencher-1 | WT Probe | ||
| 79041 | Fluorophore-2 | TCA CTG CAA CTC CAT CTG GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79036 | 0.40 uM |
| 79037 | 0.40 uM |
| 79038 | 0.40 uM |
| 79039 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.