For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 84 bp
Wild Type = 97 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
ttaattagaggattaaggtgttaatacttctttttctactgcacattttctttaaattcctagatcaaattagctttgagccacttaatgtgcatggtttctgatgaggtgggggcggtcagagaataaagaaatgtgtagaaattgatggcaaaggactaagagcaagataagagagccgattggcttctgcatcaaccccccgacccccgttttcagggtctggactggccaactagtcacctggtcacagcataaaaggtgaaactaggttcagagtcccaaagttctaggttctgagatgacccatccaatgatgtcatagaaaagttatctttctattccatccagaaTAaacggccacccaaatatacctgtgacatttcctaaagcaggagctaatgctctgtgtcttgcatgccctgcgagctgttctctattggtctctcctgacgctctgtcggaagaacgcggcattacaggaccatgcttgacaaccttgctggagcagaattgtgttacttccgttcttcttagtcagccgtgctctcggcatgttccttggggtgaattttgtttgtttgtttgtgtttgtttgtttggggggggggctttgtgaccttctcaacagagcctatttgaagctaagtaagagcaggt
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GATTCAAGAGCTAATGTAAA and TCCCATTCATCATGGCATTC. This resulted in a 24,942 bp deletion of Chr4:57,984,170-58,009,111 (GRCm38/mm10) that removes exon ENSMUSE00000879731 through ENSMUSE00000452534.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 77055 | TGT GGT GGT AGA GTT TTC AG | Wild type Forward | A | |||
| 77057 | TCC AAT GAT GTC ATA GAA AAG T | Mutant Forward | A | |||
| 77059 | Fluorophore-1 | AAA CAA TTG CTC CTG TTT TCC | Quencher-1 | WT Probe | ||
| 78959 | GGC AGC TAT GAG ATA GAC AC | Wild type Reverse | A | |||
| 78960 | GCT TTA GGA AAT GTC ACA GG | Mutant Reverse | A | |||
| 78961 | Fluorophore-2 | CCA GAA TAA ACG GCC ACC CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 77055 | 0.40 uM |
| 77057 | 0.40 uM |
| 78959 | 0.40 uM |
| 78960 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.