For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:67547995-67548097 103bp ACCTTCCCCGAGAAGTGTG CAGGAGCTTCAAGGTAGGA
Mutant= 105 bp
Wild Type = 103 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
agttttatcaaacaagtaaacaccctgaggctctgcaaaacgaacgcgctgctcgctttctgccaagttcttaaaaaaatcctggtttcccctgctccgcaggacgcgttcgtgccccgcgcaagcgcaggctcggactacacatcccagcgtgccttgcggcgctcccgccgcgcccggctgtagtcgttggtgtgggccgcgtgaatggagctccgcgcgtgaggcagcgCCccaaggtcctaccttgaagctcctgccgcccggggaactgtgggccaaagatgtaccctgccctgctcaagaaaggcctggctgccctctatcttccataagggctcttctctccgccccctcgcctggacgatggatttactggagtgaccagcgccacatcttgaggaaccttggggaacacggcccactggagtacagccaccaccgggcacggttatgggggcgggtgggcggaaggctaggttgattcctggtatcctcagtgccaccaaggctttgatttaagggaaccgggcagggaccctaaagcgcttccatcctaaagccataatgaaaccatttttgtttctcattctctacaaaatacactaagtagttttgaatccctcttcccttcggtgactcagatttgttttctctcct
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TGCGAGGGAGAGCCCTATCC and AAGCATGCCCCGCGACAACA. This resulted in a 1,039 bp deletion of chr10:67,548,021-67,549,059(GRCm38/mm10) that removes exon ENSMUSE00000497580.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 75734 | CTG TAG TCG TTG GTG TGG | Mutant Forward | A | |||
| 75736 | CAG GAG CTT CAA GGT AGG A | Common | A | |||
| 75739 | Fluorophore-1 | CCG CGT GAA TGG AGC TCC | Quencher-1 | MUT Probe | ||
| 78563 | ACC TTC CCC GAG AAG TGT G | Wild type Forward | A | |||
| 78564 | Fluorophore-2 | CCT GGA GAC ACC ACA GG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 75734 | 0.40 uM |
| 75736 | 0.40 uM |
| 78563 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.