For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 88 bp
Wild Type = 65 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase:
ccgttcttagggcttcttgcctgagtaagtctgctgatgtctgatgagggcagagttaaagccaacgccgtgcccaaaccaatggcttctctttggagtggactgggtcctctagtcagagatgaggtgtcatcccatccagtccctacctacataggctgtttacaaaatgcttctacttggagtgtgtcctctggtgtctagtaagaagtgacttaaaagcaaaggcacgcccAGgttctgctagagagaaagcagtagtcagaatcacagaggtgccttgtggataggaacatttccccaacagtgattcctcagatgctcataaatactccctttacaggtctatcttccacactctactgaaaacggccttcccacagctctgaaaggaaaactaaaacactgaaaagccttatgggtaatgtatgctctgtaagctattacaactagaactg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: AAGCAAAGGCACGCCCACAC and GAGGGCTCTAATTCTGTCCT. This resulted in a 1,875 bp deletion of Chr13:48,489,515-48,491,389 (GRCm38/mm10) that removes exon ENSMUSE00000957831.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 77531 | AAT CTT CTT GTG GCT GTT GA | Wild type Forward | A | |||
| 77533 | GTG TCC TCT GGT GTC TAG TA | Mutant Forward | A | |||
| 77534 | TCT GTG ATT CTG ACT ACT GC | Mutant Reverse | A | |||
| 77535 | Fluorophore-1 | ATA CAT ACA TGA AGC CTC GC | Quencher-1 | WT Probe | ||
| 77536 | Fluorophore-2 | CGC CCA GGT TCT GCT AGA GA | Quencher-2 | MUT Probe | ||
| 78552 | ACG TGT GTG AGG AGT GTG | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 77531 | 0.40 uM |
| 77533 | 0.40 uM |
| 77534 | 0.40 uM |
| 78552 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.