For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 99 bp
Wild Type = 129 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
gtacaagcctcaaaaaacctccagggaccccaggccctaatcaggttactgctcttccacagagaggtcacactatctagctagaaaacaagcaacgctcactcgttctaacgagtaaagggagtctaaaactcctactaacggcctaaaagtcttatgaccttttcctatctgaattgaatacacaaacaatacgccaagtccccagatttcagtactcgtgaaataagactacaactcccagaatgcaaagtggatacgtcccattggggaagtaacaatgttgcatgccgggagaaaccgggagtatACaaggcctgcctgtatccagaggccaccagggtcgccttcctcctggacaaccccaccttctatagccgagtccttcgtttacaagctgctatcaagtacagtgaaggtgacctcccaggagccaggagcctggtggagcagctgctgagtggggaagctggagaagacagtgg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TTTTAACGTATCCAGGAAGT and GAAACCGGGAGTATAATGTC. This resulted in a 4,069 bp deletion of chr2:75,977,898-75,981,966 (GRCm38/mm10) that removes exon ENSMUSE00000644392.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 78362 | AGA ATG CAA AGT GGA TAC GT | Common | A | |||
| 78363 | CTG GTG GCC TCT GGA TAC | Mutant Reverse | A | |||
| 78364 | AAC TGG GTT GGG ACA GAA G | Wild type Reverse | A | |||
| 78365 | Fluorophore-1 | AAG TTT CTG TCC CTT CTC CG | Quencher-1 | WT Probe | ||
| 78366 | Fluorophore-2 | CGG GAG TAT ACA AGG CCT GCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 78362 | 0.40 uM |
| 78363 | 0.40 uM |
| 78364 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.