For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 94 bp
Wild Type = 104 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
tcttagtcaaaccctgttgacatgctaagagccttttgcttcttggaaccctgtgagtatcttttacctgtgcccctcccagccatgaattgcctgtgctctgtagtactgttttgtgacccctgggctttcaatgtgacttgcaggcaaatgacataaccatttttctcctgaaatttcaaaaggggagaggaaaagtgcttaggccttgcgtgagactcctgctctgtgggtgggggcactctgccctttgctgaatgccttcaactcgtgtgctttgaagaaatgagggtagtgctgaacggcacagggtctcactcctcttcttctGGgactggagaagtgactcggtggttaagagcactggctgctcttctagaggacctaggcttgtttcccatcacctatatggtagctcacaagcatctgtaactccagttccaggggatgtaatgctctctttcagcttctgcagacgtttcgcttacgtggtacacagatacacatgcaggctagacaccacatacataaaattaaattgaattaaaaaaaacaaacaaaacaaagaacaacaaattcaacggctccatacaagccacaggccgaaggaaatgacattctccgagaaatgtccatgagaataaga
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGAGAGCCCAGCTTCTATAG and CCGTTTCAAATTCACCTGTG. This resulted in a 1,203 bp deletion of Chr14:63,047,434-63,048,636 (GRCm38/mm10) that removes exons ENSMUSE00001280806 and/through ENSMUSE00000446611.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76894 | AAT AAA TGG CAC CCC GTG | Wild type Forward | A | |||
| 76896 | TGC TTT GAA GAA ATG AGG GT | Mutant Forward | A | |||
| 76897 | Fluorophore-1 | TTC CCG TTT CAA ATT CAC CT | Quencher-1 | WT Probe | ||
| 77943 | CCA GTG CTC TTA ACC ACC | Common | A | |||
| 77944 | Fluorophore-2 | TCC TCT TCT TCT GGG ACT GGA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 76894 | 0.40 uM |
| 76896 | 0.40 uM |
| 77943 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.