For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = 92 bp
Wt = 105 bp
Fam = Mut
Hex = Wt
X-linked
Sequence
Large deletion: Mutant sequence with junction in uppercase
ctttttacgaagaatcttcggtgaatcaaaacattctgacataaccaaggcgggctcagcgactcaagagctcctgagagaggtttgttggtgatagttcagaaagggaggattgagAActtcccataacatagatgcatagtataaaataaatagtaactgagtgaaaacttttaatcaggaatatgttacttcaacggaatggtttgg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TGTACTAAGATTAGGTCTTT and CAAAATGACGTGGCCTAGCG. This resulted in a 2,415 bp deletion of chrX:89,930,167-89,932,581 (GRCm38/mm10) that removes exon ENSMUSE00000550440.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 77384 | AGC AAG GGA CAG CAA CTT | Mutant Forward | A | |||
| 77385 | AGG CCT CAT AAA ATC TCA TGT | Mutant Reverse | A | |||
| 77386 | Fluorophore-1 | AGG TCT GCA AAA TGA CGT GAC C | Quencher-1 | MUT Probe | ||
| 77572 | ACC AAA TTC AAG TAG GTG CT | Wild type Forward | A | |||
| 77573 | TAT CTT CAC TGT CCT GAG CT | Wild type Reverse | A | |||
| 77574 | Fluorophore-2 | ATA TAG TCC ATG CTT AGT CCG A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 77384 | 0.40 uM |
| 77385 | 0.40 uM |
| 77572 | 0.40 uM |
| 77573 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.