For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 88 bp
Wild Type = 118 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
cttcctgcattccttcagaaaacaacaagcttcccagtgataaaaacagaatacaggagaaattgcagtgggactaggcacaaaccctcatatccctgcttgatgaagaaacctagtaggaacaaaaagctcctgagcaaaggaaaaagaatcagaggcagccctactcccaatgggaggagtttcatgaatatctcaagctaaagagtcatagcttttatacagagaacgtaggacagagaagttttagagtggcccatttgataccaagaaaatgatgtgtaACcagaaagaggtatatagatttgactatagacatttttgagaatgttacattttggccaaataccatttctcttagaaatccatccattcatgaaatcacactataatataggatgcaacctgaaaattacatatgtaatttagtatttatttacccagactgtcttcacatttttctggagtccatcctgaat
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGGGTAGAGGGGACCTGTGA and TTAGAAAATACTGCAGTCCC. This resulted in a 1,598 bp deletion of Chr9:7,386,141-7,387,738 (GRCm38/mm10) that removes exon ENSMUSE00000302943, ENSMUSE00000983617 and ENSMUSE00000302891.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 77555 | GGT CAC ACC TAT TCC AAC AAG | Wild type Forward | A | |||
| 77556 | AGT CAA ATC TAT ATA CCT CTT TCT G | Common | A | |||
| 77557 | AGA GAA CGT AGG ACA GAG AA | Mutant Forward | A | |||
| 77558 | Fluorophore-1 | TGG TTT GTA TAT CCT TGG ACC | Quencher-1 | WT Probe | ||
| 77559 | Fluorophore-2 | AGA GTG GCC CAT TTG ATA CCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 77555 | 0.40 uM |
| 77556 | 0.40 uM |
| 77557 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.