For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 93 bp
Wild Type = 105 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
gccaacagatcattacatcagaaacttgtagaagtcactgttctctggtctgaaaacttccatgaaggaacagaaaaacacgtagctatcactcaccgaggtcaagtgactactacccgttcctgatgttaaggtccagtggttttgctgtttggcctcgtaaagtttaaattgttgatgagttaaatattctgagttatttttgagtaacatttcaaagtactgaactttacatagagattccaagcagtgcagacaactaaaatgtcaagcacatattggcagagtttggtaaagtgtataaaacttaaaagacagaaagcaaaaccaccttgtttaaaatgtgtaaaaataaattgcatcgcttttcagattccaatacttccttttttgtcccctctaatcttagttcgttgggacatactgcaCTcgccacatcgctgcccgccattggctacccgggcacccggggcccagccgcctagcctcgaaccgattccccgccccgggggacgaggaggggcgcacgtagcttcgatcggatcggggtctcccagcgctcgggagactcgcaggtcgcccgggacgcgaggagtcctcgtgccttggtcctggcccgccctcttctccagtccagggtgagatgttgctcacccgcgctcgggaatcaccctgcgcggcctaaggagtggcgcggccgggcaaggggaggcgatgccggggctgtggggaagagagccgaggctggtggcagctccatcccctccgcggctcagccccgccgcctctgctgcaggctcagggagcgttacgcgagcggagatcgcccttcccccggcccttcccatacccctctccgcccg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CTGCACCCGCCACAACACGT and GGCAGCGATGTGGCGAGTGA. This resulted in a 1,070 bp deletion of Chr6:24,954,662-24,955,731 (GRCm38/mm10) that removes exon ENSMUSE00000760245.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 77485 | TAG TTC GTT GGG ACA TAC TG | Common | A | |||
| 77486 | GGG CCT CAT CAC CTT GAT | Wild type Reverse | A | |||
| 77487 | GAA TCG GTT CGA GGC TAG | Mutant Reverse | A | |||
| 77488 | Fluorophore-1 | AGG TCC TGG TAC ACA CTA AG | Quencher-1 | WT Probe | ||
| 77489 | Fluorophore-2 | CAT TGG CTA CCC GGG CAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 77485 | 0.40 uM |
| 77486 | 0.40 uM |
| 77487 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.