For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:46814107-46814181 75bp TTTGTCACCAGGTACACAC TCCGATTTATTTAATGTGCATGA
Mut= 63 bp
Wt= 75 bp
Fam=Mut
Hex=Wt
Sequence
Large deletion: Mutant sequence with junction in uppercase
caaggagaccgaagtgtctggattatatagggaagcgcctctttctgggacagcctggagcccagggctgccttgatatgtatgtcctttcaaatgtgtcactctctggtgaccaagtatcagtgggcctatgggggccattctcattcagaccaccacagtttttaagtgaatcagatccaaaggatctcttgtcttcttttggcttttttttgtttgcttgtttgtttgttttccgagaccaggctgggctcgaactcagaagtctgcctgcctctgcttcccgagtgctgggattaaaggtgtgcgccaccacacccggctctcttttggccttttttgtcaccaggtacacacatCCcaagcaagtctaagacattggctgaatgccttgggacatccgttttaggaaggttaggaacttctgagaatcccacacacccggtgcctgtccctgctctctgtcactaagtccaatagtagagctctggtgttaccccactttccctcctgcctgccaggctctccatcctccactgccatggtcttgatcctcccagagcctctgatctccccacaagctggggcttcctgggagggctggcgagtggcttccagagtcaactgcaagtatctttaaagactctaggaagcgtgggtgggagatgtgacatctcttagacagtctttcctgcttcagcgcttcctgccacctgcttctgtgaagggacagaggctt
This mutation is a 6,021 bp deletion of Chr17:46,808,139-46,814,159 (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 77379 | TTT GTC ACC AGG TAC ACA C | Common | A | |||
| 77380 | TCC GAT TTA TTT AAT GTG CAT GA | Wild type Reverse | A | |||
| 77381 | Fluorophore-1 | TGT AGA CAC ATA GAC AAA TCA C | Quencher-1 | WT Probe | ||
| 77382 | GAT GTC CCA AGG CAT TCA G | Mutant Reverse | A | |||
| 77383 | Fluorophore-2 | TCC CAA GCA AGT CTA AGA CAT TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 77379 | 0.40 uM |
| 77380 | 0.40 uM |
| 77382 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.