For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:40754778+40754856 79bp TCTGGGTATGGAGCATGATA GATACCATTGTCTGCTGGAG
Mut= 109bp
Wt= 79 bp
Fam=Mut
Hex=Wt
Sequence
Mut Sequence (junction in lower case & blue):
cttggaaaattaaaatttttacttacccccatcctttgactgtacttcaactgaattaaacagaaaatctaatgcactttgtagagtcatgcctttgaacaaacctcagccatttaagctcacatcttgttctttctcttccactgtggcctgcccatactgaaatactccaatttctgtcttttcatttagTCCTGCTACttATACTGAAAACTATACTGAAAAGAAACACAAGAAAAGTATTGGGCTAGTAATTCTTTTTTGGATTCTTTTTGCTTGTTTTTCCGTATTGTTCATTGTGTTCCTTTTTTTCTTGAGGA
This resulted in a 2,119 bp deletion of Chr8:40,753,650-40,755,768(GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 78901 | TCT GGG TAT GGA GCA TGA TA | Wild type Forward | A | |||
| 78902 | GAT ACC ATT GTC TGC TGG AG | Wild type Reverse | A | |||
| 78903 | Fluorophore-1 | ACA TGT GGA AGA AAG ATT TGC | Quencher-1 | WT Probe | ||
| 78904 | CCT GCC CAT ACT GAA ATA CT | Mutant Forward | A | |||
| 78905 | AGA ATT ACT AGC CCA ATA CTT T | Mutant Reverse | A | |||
| 78906 | Fluorophore-2 | TCT GTC TTT TCA TTT AGT CCT GCT ACT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 78901 | 0.40 uM |
| 78902 | 0.40 uM |
| 78904 | 0.40 uM |
| 78905 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.