For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 91 bp
Wild Type = 107 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
agtttgttgagctatgttcaggaggtgagtattgactacacaagctaatccctctgtagctcatcaaacaaggaatggaaggcactgcctgcgtgcagtgtttgtatatggctttcccagaactcttgaaagatatacgttttggttggatatatttaaaattagtaaccccacttcacactaaaatttcctgattgggacattaaaatatgtaatctccatactgtaaaggctcagggcaggtctcctagaacatcagagaaatcatactgatgatgttcctcaaagttctttttgagtagagtaagtcccaatctattgaatgatttatatgactcacatagttttagaaaatacactcaaaagttctctatggtggtgaattggcttagaattgactttgttactggatattaagttcatcacattttggctgaaactcctatcctACaattacattacaatcattcattgcatacgttgctgatatcaatagatgaaatcaatcttatgaggcaataaagaggtcctgcctttggagacaggaagggacttaataaggcccactgaccatgtgaagagaacagaggcactaaatcaaggcatctcactcgccccttattggctgacagaaagagcagagaaaccagagctcctaatctaactccaggtcaaacccctgctcctcaagtttaacctttagacatcttagttttctgcttgtgtttctgtacccaaataatgaggtcatttactacaacaactaaaatttcgatttaagtctagaaccatacgagaagtaagttgcaatatgtgcctaaatcaaatggaagacacagaccttagctcacagttgcttgtacttacaatgggcatgctc
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: AGGTTTATTGAATAGGCTGT and ATTGTAATGTAATTGATGCT. This resulted in a 1,349 bp deletion of Chr6:121,744,702-121,746,050 (GRCm38/mm10) that removes exons ENSMUSE00001366114 through ENSMUSE00001367183.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76636 | AAT GCT ACA GTT GTG TCC TT | Wild type Forward | A | |||
| 76637 | ACG TAT GCA ATG AAT GAT TGT | Common | A | |||
| 76638 | AGA ATT GAC TTT GTT ACT GGA | Mutant Forward | A | |||
| 76639 | Fluorophore-1 | CCC CTG TAG TGC TCA TTT T | Quencher-1 | WT Probe | ||
| 76640 | Fluorophore-2 | TGG CTG AAA CTC CTA TCC TAC AA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 76636 | 0.50 uM |
| 76637 | 0.50 uM |
| 76638 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.