For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 87 bp
Wild Type = 99 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
aacagacaacttgacacctttctttccatggcaaacttttgtcaaaacagcccgagttctgcagggcctccctgttggtggagtgagacaccacacggtaaataaacaccaattttcagaaaagcttgcaaagactgtccccagtgtgtgggaactggcccacttgttggtttggcttacataggacatgattgctcggcccacagttcctccaccctcagggccgcccacttccaggcgcctagaaaagcacttctagagaggctgtacagctgcctccagcatcagaatttgccatatgttcattgctctctgactgcctccctaGTatatccagacttgctgaaggcaaggacatttataatgtagtaacacttctgaaaaataaacatagaattctttgaatgcacagaggtttacaaatgtttttaagttatcctttattttgttcatatgattgtctttggtgtatatcaggaagggtgctacacccatacagtgctcttgagtgccaggagagacagtggatgccaggaactgggcataaaggtgttgtaagcctgtttgtgtgtgctggaaaaggagctctggcctctacaagagcagcaagggagcttccctgctgagccatgtcttctgtcctcatttctacagatgcct
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GACATGGCTGCGTGTTCCTA and CAGCAAGTCTGGATATAAGG. This resulted in a 2,287 bp deletion of Chr16:93,628,085-93,630,371 (GRCm38/mm10) that removes exons ENSMUSE00000720738, ENSMUSE00001039070 and ENSMUSE00000714002.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76627 | TGG GCA GTT TGT TCA AGA TA | Wild type Forward | A | |||
| 76628 | ATA AAT GTC CTT GCC TTC AG | Common | A | |||
| 76630 | CCT CCA GCA TCA GAA TTT G | Mutant Forward | A | |||
| 76632 | Fluorophore-1 | AAC CCA ACT CTT CCC TTT CA | Quencher-1 | WT Probe | ||
| 76633 | Fluorophore-2 | TGC TCT CTG ACT GCC TCC CTA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 76627 | 0.40 uM |
| 76628 | 0.40 uM |
| 76630 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.