For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 100 bp
Wild Type = 122 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
actttcctgtgcacacctcaagcacctcagcatccctgaggatttccctggagcccagcgcctgacagccagaccgggtttgtcgctgtggaggattgttttaacattgtctccctgctccgaggttacctgaggccagaggtgacaattttcctgatctgcgcagtcgctccgccctcccgtcccgtcctgtgcgcacgcgccgcacctcaaggcgctctcacccgcgcgctgcccgctgggtgtcccccgccctggcctagggtggtgaggggaacacgcatgcgcacactcgcctgaccccgcccccagaGTgtgcattggaaaacacaaatgtcaatgaatttgttcccctgtgtgtgtgtatgcagtatttatttttgatcctttaaaataaaatgctggcaaagccgttgtgtttctagagtgtgtggtcttttttaagatgaatcacttacccccagaacccagaaggaatatatatatatatatatgtatgtatgtatgtatgtatgtatatgtatatatcaatgccatatataataacattatatatacatatatatacatacatat
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CAATGCACACTTTCAATACA and CTCCGCAGGGCCTCCATGGC. This resulted in a 4,723 bp deletion of chr9:63,394,545-63,399,267(GRCm38/mm10) that removes exons ENSMUSE00000891268 and ENSMUSE00001014548
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76608 | AGA CTG TTC ATA CCA GTT ACG | Wild type Forward | A | |||
| 76609 | ACA CAG GGG AAC AAA TTC AT | Common | A | |||
| 76610 | CTA GGG TGG TGA GGG GAA | Mutant Forward | A | |||
| 76613 | Fluorophore-1 | AAG AAG ATG AAG GTG CCA TG | Quencher-1 | WT Probe | ||
| 76614 | Fluorophore-2 | ACG CAT GCG CAC ACT CG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 76608 | 0.50 uM |
| 76609 | 0.50 uM |
| 76610 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.