For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 104 bp
Wild Type = 114 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase:
aaaaccactcagctaatctcagcaaagattagtcttccagagtgcaaaccagagccatgaaacactcagtcaaacagaaagtaaccaggtcaccacacttcactgttgaccctctgcaaagaagtgctatcttttaaactttcactaaaagaacatgtgtgttctggtaacattttttgtttgtttttgaagctacccctaacacactattctacacacagaaaatgctcttcactagtggcattgccatgggttgcagggccagcctgcctgaacaggatgtaagaggaacaacccattgtgaggacacatagattgtttctcaagttctagaattcccagaggctctgattcaacactgggagcgtttgctcagtttcttctcagctcttgagtgtgccacattagagatctttatttaCCactctacttggctcaatttatgttcaacttcaacaactaatcacatcgggctctgcctgatcaccagataagaagctcaaaccttgtctttattgataccccattgcctatgtcctctgccttactttgctcccatccttccgcagatgttcttttttgcaataaattgctattaaagaacataggcttcagtcagattgtttttcatcagtctagtttgcaaagttattgtttctg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TAACTCCTTCATTTTGATTT and CTTCTTGCTCTGACTTAGGC. This resulted in a 5,361 bp deletion of Chr9:36,693,302-36,698,662 (GRCm38/mm10) that removes exon ENSMUSE00000216596 through ENSMUSE00000395690.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76603 | AGT TTC TTC TCA GCT CTT GA | Common | A | |||
| 76604 | GAC TTA CCT TGG GCA GAT C | Wild type Reverse | A | |||
| 76605 | CAG AGC CCG ATG TGA TTA G | Mutant Reverse | A | |||
| 76606 | Fluorophore-1 | ACT GGG TCT TTA TCT GCT TG | Quencher-1 | WT Probe | ||
| 76607 | Fluorophore-2 | ACC ACT CTA CTT GGC TCA ATT TAT GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 76603 | 0.40 uM |
| 76604 | 0.40 uM |
| 76605 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.