For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 67 bp
Wild Type = 82 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
ataaaagaacaagaagtataaagatcatctttttcttgccttagatatattgtgttccaccccccaccccagacaaaaaataacacatagaagtttgctgaaaaactgttatcaagcagaatcagggaaaactcagctcccctgagcagcacacagacctccttggctgcacttcactgctcattgcccaaggccatgaagaggccaataaaggccagagctcaagaacactagtccagaccccGGgctcccatggcagtggggaaagcatattagtgggtagcaggtctttctcctggggcatcaggctcctctctgcttccacaggcattaaaataagacataactgttctgtaacccagaaatacaataaatagcattgacacctccagtctgtgtaatgaggtcattcttcctggcgtcccccagagggctgagctacagagggctggattttaaatttagatgccagg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GACCACCTTAGACATGCCCA and CTGAGTGGTAGAAAAGCCCG. This resulted in a 5,473 bp deletion of chr2:152,459,140-152,464,612(GRCm38/mm10) that removes exons ENSMUSE00000640004 and ENSMUSE00000640003
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76564 | ACC CAC TAA TAT GCT TTC CC | Mutant Reverse | A | |||
| 76565 | Fluorophore-1 | TTT CTA CCA CTC AGC CAT GA | Quencher-1 | WT Probe | ||
| 76569 | CCA GAG CTC AAG AAC ACT AG | Common | A | |||
| 76570 | GAC TGG CAA AGA GAG GAA A | Wild type Reverse | A | |||
| 76571 | Fluorophore-2 | CGG GCT CCC ATG GCA GTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 76564 | 0.50 uM |
| 76569 | 0.50 uM |
| 76570 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.