For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 110 bp
Wild Type = 135 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase:
tttctcaacagcagctcgggtttcttttaaccatcggaagcaaaggcactggataaaacagcactcgggctttctacaaaggtggggcacccacaagaccctccagaaaggattgcaaatctataaattcccaaaggtccagatgagcggaaccactctctgagctgccagagactgagtggaaacagcacaacagaaagcattttgtctaaggagtgatggagcctggagttggagctgctcagcatataaggcaagtgctgcttttctttgttttcctggAAtattcggttcctaaagcctgtctcccaaccttgagcaggccgcgaaatgcgtgaaagaaaacacctcctctatgaatcagtttggatacaattagcaatttgttgactctcatcatggttcctgatgtacactggttctttttaaacattcttgttttctatcattttattttcatgagaaacatctaaagttttgcctttattttcctaattcagtagataactttcatttttatccttacaggttggtctcaaaaaaaaaaaaatcatttcctgatgaagacagagaatactcattactgacaaatcccagtttcttcaacttgttaaattctcaaaaattaatcattattgatttgaaaatcctcaccttcattctgttgttttgaagcattgatgttttgaagataaaggagatacaaatgtaatgaattatcagagtatcttctgtctaatctaatattatgctttcctatctagaatagttagagtgtctgaaaaatgcatggttttgttgtacagcagaattaatcagaaatttctctgaaatgtcaagacttttactgatttaatgaatgtccaacatgtaatacatataaatattgtttaaatattttta
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CAAGAACCGAGGACCCTTCC and CTTTAGGAACCGAATATCAT. This resulted in a 2,225 bp deletion of chr18:37,513,885-37,516,109(GRCm38/mm10) that removes exon ENSMUSE00000343717.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76527 | CAA GTG CTG CTT TTC TTT GT | Common | A | |||
| 76528 | CAG ATC ACC CAC ATC CAT AT | Wild type Reverse | A | |||
| 76529 | CTG ATT CAT AGA GGA GGT GT | Mutant Reverse | A | |||
| 76530 | Fluorophore-1 | AGA AGA AAT GGA GAC TGG CT | Quencher-1 | WT Probe | ||
| 76531 | Fluorophore-2 | AGC CTG TCT CCC AAC CTT GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 76527 | 0.40 uM |
| 76528 | 0.40 uM |
| 76529 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.