For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 97 bp
Wild Type = 118 bp
>chr6:146998254+146998371 118bp GGAGAAGGGATCGAAGTC TGGAGTTGTTGTTCTACTGTCCA
Sequence
Wt Sequence (deletions in lower case):
GGGACGATCCCAGAACCATGAGTGTCACCTTGAAATGCTGAGGGAACCAATCCAGCCTCTTTGAATTTGCTTTTTATTTTGCTTTTAAGACAAGTATCTAATTTGGTCATCTTCAACTAACTTGGTGAGACTTTGATTTAGcgcaggcagaactttagagagtactcggtcttggttatacttcaacttcttacatttacccacaaacttgaaacatttacactgcaattattacaaattatttatattaatggtgtttatccttgcctctgtctaatttgtgtttgcgtgtaagtttttgtgggtttttgtctcattcctatagtctgagtattgatttttaaagggctaataccgctttatgcgtattccttttctgccatagtctactgttttaaaatgaatttataatttgtaggacgaattggcatctttaaaagagcaactggaggagaaggaatgtgaagtaaagaggctgcaggagagactggtttgtaaggcgaaaggagaagggatcgaagtcctcgatcgaggtaaggctgactgtggtactcgatggtttcattgtgatcctgtaaacTGCAGGAGAGGATCTGCTGTTGGACAGTAGAACAACAACTCCAATGACATTTTAAACTCCAATGACATTTGGATCTGACCTCTGCAGCTCTAGCACGTGGAAATGGAAGCAGA
This mutation is a 439 bp deletion beginning at Chromosome 6 position 146,997,890 bp and ending after 146,998,328 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67803 | TGG AGT TGT TGT TCT ACT GTC CA | Common | A | |||
| 75972 | GGA GAA GGG ATC GAA GTC | Wild type Forward | A | |||
| 75973 | AGA CAA GTA TCT AAT TTG GTC A | Mutant Forward | A | |||
| 75974 | Fluorophore-1 | ACT TGG TGA GAC TTT GAT TTA GTG C | Quencher-1 | MUT Probe | ||
| 76278 | Fluorophore-2 | TCG ATG GTT TCA TTG TGA TC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67803 | 0.40 uM |
| 75972 | 0.40 uM |
| 75973 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.