For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 84 bp
Wild Type = 92 bp
Sequence
Large deletion. Mutant sequence with junction in uppercase:
ttctcgccggggccagggttagattcccaacatctacagccagcccacaaccgtctggaaccccagttccgatgccctcttctgacctctgtgggcaccgggcacacacatggctcacagacatacatgcaggccaatcactcatacttgtataataaaaggaaaaagaaacaacaacaaaacccatacaaagcatCAtttgcacacacacatccatccttgcttgaaatatctcctatcccatccctagctggcctgtctatagctagcattcattgccttcagggcatccctcaatactactccggagcttggttcacactggtatgtattggatggttacatagttcaaaattagactccggtgtcaagagtacacaggttcagaactcggcatacgcacagtgctagctatgcaattcagttctattacaacagga
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CTGTTCACTGATCCAATAGG and ATACAAAGCATCTTTAGACG. This resulted in a 1,289 bp deletion of chr15:79,077,860-79,079,148 (GRCm38/mm10) that removes exons ENSMUSE00000227221 and ENSMUSE00000227215.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 76049 | AGA AAC AAC AAC AAA ACC CA | Common | A | |||
| 76050 | TAG CTT TGT CAG ATG CCT AC | Wild type Reverse | A | |||
| 76051 | CTA GGG ATG GGA TAG GAG AT | Mutant Reverse | A | |||
| 76052 | Fluorophore-1 | AGA GAC TGT GCT AGA GAT GG | Quencher-1 | WT Probe | ||
| 76053 | Fluorophore-2 | TGC ACA CAC ACA TCC ATC CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 76049 | 0.40 uM |
| 76050 | 0.40 uM |
| 76051 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.