Protocol 49687: Probe Assay - Tubgcp5<em1(IMPC)J>
Version 1.0

Notes

Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut= 122 bp

Wt=110 bp

>chr7:55799641+55799750 110bp AGGAAATCTCTTCACTAAGCC AGTGTGTATGCTCATCATGG

Sequence

Large deletion:  Mutant sequence with junction in uppercase

tagatgtgcagtatttgtgctgaatgtaaatgtgattcttatagaggttatagtcaaataggcaaactgttagatatgtttaatcttcaggatgcatattgccactggaaaataacatcacttagccataatgtcatgttctagagaattatattacagttcctatagaaataaaatctttaacccagtcaaatgtcttacacttgttagaATctcgggtgacaggctgatgactgatggcattgatgacactatcgctgagctctgacatttccagtacagtgcttctcagcactcctaatgctgcagccctttcaggaagt

This mutation is a 2,192 bp deletion of Chr7:55,798,614-55,800,805 (GRCm38/mm10)

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
76040 AGG AAA TCT CTT CAC TAA GCC Wild type Forward A
76042 AGT GTG TAT GCT CAT CAT GG Wild type Reverse A
76043 CCA TAA TGT CAT GTT CTA GAG AA Mutant Forward A
76044 ATC AAT GCC ATC AGT CAT CA Mutant Reverse A
76045 Fluorophore-1 CTG CAT GCT GAG AAG ACG Quencher-1 WT Probe
76046 Fluorophore-2 CAC TTG TTA GAA TCT CGG GTG ACA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
76040 0.40 uM
76042 0.40 uM
76043 0.40 uM
76044 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.