For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 103 bp
Wild Type = 111 bp
>chr11:94636129+94636239 111bp GACATCCTGACAAGTGAGAG TCACAGTGCTGCTCTTAAC
Sequence
Large deletion: Mutant sequence with junction in uppercase
tacagagggaactccctctgtagaccagactgacctagaactcatagagatctgtctgcctctgcctcctgagtgggttgtatgcatttctcatgatgattTCctgcaggagcaggatctatagcagagtgctggagaggcagggttgtg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCTGTTTTACAAGCTTGTCT and CTGCAGGCTGATTAAGGACA. This resulted in a 4,299 bp deletion of chr11:94,634,348-94,638,646 (GRCm38/mm10) that removes exons ENSMUSE00001286541 through ENSMUSE00000110773.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 75786 | GAC ATC CTG ACA AGT GAG AG | Wild type Forward | A | |||
| 75787 | TCA CAG TGC TGC TCT TAA C | Wild type Reverse | A | |||
| 75788 | CCA GAC TGA CCT AGA ACT CA | Mutant Forward | A | |||
| 75789 | CTG CTA TAG ATC CTG CTC CT | Mutant Reverse | A | |||
| 75790 | Fluorophore-1 | TTT ATG GCA GAC AGA GAC CT | Quencher-1 | WT Probe | ||
| 75791 | Fluorophore-2 | TGC CTC CTG AGT GGG TTG TA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 75786 | 0.40 uM |
| 75787 | 0.40 uM |
| 75788 | 0.40 uM |
| 75789 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.