For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 164 bp
Wild Type = 180 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
gcttcatttttaaaatcactattgtttgttttgttttgtctggagatagtttttctacctagctttggctggttaaacgtatgatcttcctgccttagcttccagagtgcttggattagcaggtatgcatcaccacaactggctagttgatcttttaaatgcacataatgctaaaattagcagaattagtataatatgtagtaatatatatgtatatgatataaaattattttgtgtgttaatacagttGCacggaaccaccggtcagggcccttctgcttgatgggtacaactgtctgtgcttgcttggactgccatttgccttgcagggttgaggtcgtagattatacttgtgtgccttttttggctatgtttcatagtaacaggcattggagaggagatgagagggcatcagaaagaataatcagaatgctctgtgtgtgtgtgaagttgtcagatggcaaaaacaatagttttcataatgaaagaatgctgtcctgttagtctggccttagaggtgaccttggtgagccctcaattttgctccctccatgagatgtgtcatcaccttctcccaagacaccatgcttcctacttttcctccagcctctgacttcatttctggttgtgcagctcctatgtcatctccacagtgcctat
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TGGCTCAGTTTTGTGCAGCA and GTTAATACAGTTGCTATGGG. This resulted in a 4,963 bp deletion of chr2:28,830,457-28,835,419 (GRCm38/mm10) that removes exons ENSMUSE00001238880 and ENSMUSE00000223849.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 75771 | AGA GGC TCC TAT GTG TTT TG | Wild type Forward | A | |||
| 75772 | GAA AAT GGG AAT CAA CTG CC | Wild type Reverse | A | |||
| 75773 | GGC TAG TTG ATC TTT TAA ATG CA | Mutant Forward | A | |||
| 75774 | AAG CAC AGA CAG TTG TAC C | Mutant Reverse | A | |||
| 75775 | Fluorophore-1 | CTC TAG TGA TGG GAA GGT GA | Quencher-1 | WT Probe | ||
| 75776 | Fluorophore-2 | CAG GGC CCT TCT GCT TGA TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 75771 | 0.50 uM |
| 75772 | 0.50 uM |
| 75773 | 0.50 uM |
| 75774 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.