For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 98 bp
Wild Type = 107 bp
>chr4:141991123-141991229 107bp CAGAGAAGTTGGTCACAGG GGGTCCATCACAAAGGAAA
Sequence
Large deletion: mutant sequence with junction in uppercase
gaggaacatgcaagaaggtttCTctgaatatagactataactagttgtaaaaagtataatggtgggcaggcgaaagggctgaatagggaaaggagcct
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TAGTCTATATTCAGAGTCAG and ATGCAAGAAGGTTTCTCGGA. This resulted in a 415 bp. deletion of chr4:141,991,015-141,991,429 (GRCm38/mm10) and removes exon ENSMUSE00001307006.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73281 | GGG TCC ATC ACA AAG GAA A | Wild type Reverse | A | |||
| 75577 | CAG AGA AGT TGG TCA CAG G | Wild type Forward | A | |||
| 75578 | GAG GAA CAT GCA AGA AGG T | Mutant Forward | A | |||
| 75579 | AGG CTC CTT TCC CTA TTC A | Mutant Reverse | A | |||
| 75580 | Fluorophore-1 | TTG TCC CAG ACC CAC CAT | Quencher-1 | WT Probe | ||
| 75581 | Fluorophore-2 | TAA TGG TGG GCA GGC GAA AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73281 | 0.40 uM |
| 75577 | 0.40 uM |
| 75578 | 0.40 uM |
| 75579 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.