For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
SEQ
gcatccttggaccctgaccactatgttctctggcagATTTTTGTGGTCAACAACCAGGAAGAGCTTGAGAGGCTGAACACTCAGAATGCCATTGCCTTTCGAAGAGACCAGCGATCTTTGTACTTCAAAGATAGCCTTGGCTGGCTCCCCATCCAG(g/a)tactctggggctggacacttaggctgtgatccccctgtccttagccaggagagagatgctcccactagaaggaagaaaagctagacaatcgaagcaggacggagcttttgctgtgtgtctgtaggagagggccgaacatcctccctccttcatcttctgggcagccctccacagtcccatgcccaaacagaagctcaccctgagccaggaccccctttgggaaagat
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 75344 | ACC AGC GAT CTT TGT ACT TC | Forward | A | |||
| 75345 | GAT CAC AGC CTA AGT GTC C | Reverse | A | |||
| 75346 | Fluorophore-1 | CCA TCC AGG TAC TCT GGG | Quencher-1 | WT Probe | ||
| 75347 | Fluorophore-2 | CCC ATC CAG ATA CTC TGG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 75344 | 0.50 uM |
| 75345 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.