For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 101 bp
Wild Type = 114 bp
chr19:23593212-23593325 114bp GGAATTGCTATTTTCAGAGGC CCTACTAGGGGCATATTCAG
Sequence
Large deletion: Mutant sequence with junction in uppercase
taaagaaaagaaatgaggaagagtcagtacctggtcgaatgagtacttcctattttatgggagaaactaattgctttttattttccaacaccacacaggaattgctattttcagaggcttatgatGActtattcaaagttcaactaaaactcgcatttgatttagatagttttctggctcagggttcttactacctcaaccttaattaactatttgaagactgcttctacaattcactcatgaaagctatttggcatc
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCTTAACTCCTAACTCGTCA and GCTTATGATGAAATAGTCCG. This resulted in a 453 bp. deletion of Chr19:23,592,844-23,593,296 (GRCm38/mm10) and removes exon ENSMUSE00000249857.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 74809 | GGA ATT GCT ATT TTC AGA GGC | Common | A | |||
| 74810 | TGA GGT AGT AAG AAC CCT GA | Mutant Reverse | A | |||
| 74812 | Fluorophore-1 | CGC ATT TGA TTT AGA TAG TTT TCT GGC | Quencher-1 | MUT Probe | ||
| 74863 | Fluorophore-2 | CCG TGG CTA TGA GCT ATT TT | Quencher-2 | WT Probe | ||
| 74864 | CCT ACT AGG GGC ATA TTC AG | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 74809 | 0.40 uM |
| 74810 | 0.40 uM |
| 74864 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.