For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 84 bp
Wild Type = 130 bp
>chr17:29570550+29570679 130bp TCCTGCATAGTTCTTCCTCT CATTCTGGTCTGAGATCCG
Sequence
Large deletion: Mutant sequence with deletion junction in uppercase:
gtgtcaccatgtacattcttagaagtcaccatctgggcaacatctggggttagctggccgcagctgtcctctgtggtgcatatgcagtccctgtgtgtgggagtagagccctgcagggcctcattctcactgttcctgactggagcctcaggaggccacaggctcaggcctTGccagtatctgactcctgtggtcacagtgtcacttccttaactgtggggaggcatctagcaggacaggaggatccacggactggcgctgagctagcatcaccactcctgacagcggctggaaatccacttcccagcttcatgagaagagttaggctgtggggctctcagaagcaggctgctcttgctttcccatactcagatctcacggctcctgctttgggatgcttgattctgagcctctgagatt
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCAGGAAGTTAGACGCCCCA and GTAGGAATATACTCACCTGC. This resulted in a 1,433 bp. deletion of Chr17:29,570,497-29,571,929 (GRCm38/mm10) and removes exons ENSMUSE00000417027 and ENSMUSE00000417022. Founder 19M
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73305 | TCC TGC ATA GTT CTT CCT CT | Wild type Forward | A | |||
| 73306 | CAT TCT GGT CTG AGA TCC G | Wild type Reverse | A | |||
| 73307 | Fluorophore-1 | TTC AAA TCC CTT CAG GTG AC | Quencher-1 | WT Probe | ||
| 74569 | CTG ACT GGA GCC TCA GGA | Mutant Forward | A | |||
| 74570 | CCA CAG TTA AGG AAG TGA CA | Mutant Reverse | A | |||
| 74571 | Fluorophore-2 | AGG CCT TGC CAG TAT CTG ACT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73305 | 0.40 uM |
| 73306 | 0.40 uM |
| 74569 | 0.40 uM |
| 74570 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.