For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 114 bp
Wild Type = 118 bp
>chrX:100606952+100607069 118bp ATGGTGGTACATGCCTTTAA GAAATACATATGCAGTGGGG
X-Linked
Sequence
Wt Sequence:
ggtctgagcgagtgggactaactggagtaagtgaagttaaccagagtgagcagaggtcctagaaattcaactcccagcaaccacatgaaggctcacaaccatctgtacagctacagtgcactcacataaaataaataagtcttttttaaacagtaagtatattaagccaggcatggtggtacatgcctttaattccagtacttaggaggcagggctaCAtagggaaaccctgtctcaactggcccccaatgatgtctagttttgtttctcccccactgcatatgtatttcattctcattttgacatccttcaccctgcttacctctaacacattgctatctttttctgttgcag
Mutant Sequence:
atttcaggtgtcgtgaGTGAACCGTCAGATCCGCTAGCCACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCTCTCTCCCAGCGACACATGAGTTACACATCTTTGGCTCC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73477 | ATG GTG GTA CAT GCC TTT AA | Wild type Forward | A | |||
| 73478 | GAA ATA CAT ATG CAG TGG GG | Wild type Reverse | A | |||
| 73481 | Fluorophore-1 | CAG GGC TAC ATA GGG AAA | Quencher-1 | WT Probe | ||
| 74059 | ATT TCA GGT GTC GTG AGT G | Mutant Forward | A | EEF1A Promoter | ||
| 74060 | GGA GCC AAA GAT GTG TAA CT | Mutant Reverse | A | mNeonGreen | ||
| 74061 | Fluorophore-2 | TCA GAT CCG CTA GCC ACC AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73477 | 0.40 uM |
| 73478 | 0.40 uM |
| 74059 | 0.40 uM |
| 74060 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.