For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 108 bp
Wild Type = 128 bp
>chr2:172454163-172454290 128bp GTCATGAATCTCTGTGGACA TTGGGTTTGGAGTTTGCG
Sequence
Large deletion-- Mutant sequence with junction in uppercase
agatggctcagtggttgagagcgccgactgctcttccgaaggtcctgagttcaaatcccagcaaccacatggtggctcacaaccatccgtaacaaaatctgatgccctcttctggagtatctgaagacagctacagtgtacttacatataataaataaataaatctttaaaaaaaaaaaagaacatacagtgaatgtgcttcagcaggggctggaggaGGttgactcttttagatgtcttgctgtggctacctacgtacagagcctgcatctcacaaggccttccacttggggtagcctcttgttttaggaatgtggcatcagggggacagtcttgccatgtgcctatccaacctgtgtctctttcaacagactcttttggaaatcctgggcataaatgtttggaaaaatctgcatttttgctaagggctcatcctataaatcacagttcttgtgaagctgaggcaggaggacagctgtacagtacagcctgagctgagtgaggtcttgactagaaaacagaaaaacaaaaaaaaaaccc
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCAGTGAAGAAGCTGGCGGG and ACAACAGAACATTTAGAGTA. This resulted in a 1,127 bp deletion of Chr2:172,453,871-172,454,997(GRCm38/mm10) that removes exon ENSMUSE00000638946. Founder 10M
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73390 | GTC ATG AAT CTC TGT GGA CA | Wild type Forward | A | |||
| 73391 | TTG GGT TTG GAG TTT GCG | Wild type Reverse | A | |||
| 73392 | Fluorophore-1 | CTA TGA CAT CAG AAC CAG GTG | Quencher-1 | WT Probe | ||
| 73393 | AGA ACA TAC AGT GAA TGT GCT | Mutant Forward | A | |||
| 73395 | Fluorophore-2 | ACC TAC GTA CAG AGC CTG CA | Quencher-2 | MUT Probe | ||
| 74207 | GTG GAA GGC CTT GTG AGA | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73390 | 0.40 uM |
| 73391 | 0.40 uM |
| 73393 | 0.40 uM |
| 74207 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.