For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 109 bp
Wild Type = 126 bp
>chr18:69955818+69955943 126bp TGAAACACAAAGGACATTGC CGCATTCACACACTGTTTAT
Sequence
Wt Sequence (deletion in UPPER case)
gcatggggaaggtgggtgggcaaagttacactaccacggctccactttggcagtgggctggagaaggagcaagctcgctctttcagctaaatgaataagttatggggagattttttgtttattttgagacaggctctcatgcatctcagactgaccttgaacttactatgtattggtagctggtcctgatgctcctgtctctacctccacagtgctaggattaaccccatgtagacccctgcccatgttaaacatactaacaacacagcactgatctacttatgaaacacaaaggacattgcctgaccaggctccttggtGGCACATGGTTACTATGATGAGCTCTGAAGCACAGGCCATATTTCTAGCATCATAAAACACATATATTATAAACAGTGTGTGAATGCGTGCACACACAAAAACTGCATCTTTTTTTTTTCTCCTAGGAAAAGAAAACGCTCTTAGAGAAAAAATTGCGTTTAGAAAGCAAACTGTTCCAGCTTAAATCCAACGCTGCAAATCCAAAAAGGTTTGAAAGTCTAAGAGCAGCTTCTGATAGCTTTCCTGTTTGTGGCTGggctgggctgcaggcacaatggatttatgagcctagaactctgcctctctaccttcctattgctatgaccctttaagacagttccttgttttgtggtgactccaaaccataaaatcacttccttgctacttcatgactctaattttgatactgttgtgaatcgtcatgtaaatgtctgagatgcaggatctctgatatgcgaaccccagaggggtcgtgacccacacgttgaaaactactgacccaaagggagttgaggaaatagggtgaatgcagggggataggacggcaaactcctaatattaacagacactcgggccaga
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATAGTAACCATGTGCCACCA and TTTCCTGTTTGTGGCTGGGC. This resulted in a 257 bp. deletion of Chr18:69,955,856-69,956,112 (GRCm38/mm10) and removes exons ENSMUSE00000326539. Founder 20M
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73319 | TGA AAC ACA AAG GAC ATT GC | Common | A | |||
| 73320 | GGG TCA TAG CAA TAG GAA GG | Mutant Reverse | A | |||
| 73321 | Fluorophore-1 | TGA GCC TAG AAC TCT GCC TCT | Quencher-1 | MUT Probe | ||
| 74075 | CGC ATT CAC ACA CTG TTT AT | Wild type Reverse | A | |||
| 74076 | Fluorophore-2 | CAC AGG CCA TAT TTC TAG CA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73319 | 0.40 uM |
| 73320 | 0.40 uM |
| 74075 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.