For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 103 bp
Wild Type = 119 bp
>chr14:122891493-122891611 119bp CAGGTGAGATCTACGAGGT GTCACCCTCCCACTCTAG
Sequence
Deletion in lower case
TGGCCAGCAGAGTGGAAGGACTGTGGTCGTATTACCCTCAGTCCAGAGGCTTTCCCCAAGAAGACTCTTCATCTGCTCATGTGCCTGCCTGCTTTCTCCTCCAGAGTGCCTGCAGACAGATGGCCCACATCTTCgtgtatggcaccctgaagcgcggccaacccaaccacaaagtcatgctggaccattcacatggcttagcagccttccgaggccgaggctgcacagttgagtccttcccactggtgattgcaggcgagcacaacataccttggctgctgtacctaccaggcaagggccactgtgtgacaggtgagatctacgaggtggacgagcagatgttgcgtttcctggatgactttgaagactgccccagcatgtaccagcgcacagccctgcaggtgcaggtgctagagtgggagggtgacggtgaccctggggacagtgtgcagtgctttgtgtacactacagccacctatgcacccgagtggctgtttcttccctaccatgaaagctatgattctgagggtccacatgggctacgctacaacccccgggaaaacagataaagggcTGTGCCCCAGACGCCAACAGGATGGAGGGAACCAGATAGCTTCCTGGCATAAGCAGAGCGTTCCAAGTTCAACTCTAAAGCATGCTGACAAAACATTTTTGTCATATACTCTAATCTGATGTGACTTAATACTGCTTTAGTCTTAAGGAGCACCTGGACTTGCAGGTACTAGATAGGAAACACTCTAGACTGAGGTCCCTGGTTCT
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCCCCGGGAAAACAGATAAA and ATGGCCCACATCTTCGTGTA. This resulted in a 440 bp internal deletion of Chr14:122,891,347-122,891,786 (GRCm38/mm10) that removes exon ENSMUSE00000332841.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 72997 | CAG GTG AGA TCT ACG AGG T | Wild type Forward | A | |||
| 72998 | GTC ACC CTC CCA CTC TAG | Wild type Reverse | A | |||
| 72999 | Fluorophore-1 | CGT TTC CTG GAT GAC TTT GA | Quencher-1 | WT Probe | ||
| 73002 | Fluorophore-2 | CCT GGC ATA AGC AGA GCG TT | Quencher-2 | MUT Probe | ||
| 73860 | ATG GCC CAC ATC TTC TGT | Mutant Forward | A | |||
| 73861 | TCA GCA TGC TTT AGA GTT GA | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 72997 | 0.40 uM |
| 72998 | 0.40 uM |
| 73860 | 0.40 uM |
| 73861 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.