Protocol 48658: Probe Assay - Ggact<em1(IMPC)J>Alt 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  103 bp

Wild Type = 119 bp

>chr14:122891493-122891611 119bp CAGGTGAGATCTACGAGGT GTCACCCTCCCACTCTAG

Sequence

Deletion in lower case

TGGCCAGCAGAGTGGAAGGACTGTGGTCGTATTACCCTCAGTCCAGAGGCTTTCCCCAAGAAGACTCTTCATCTGCTCATGTGCCTGCCTGCTTTCTCCTCCAGAGTGCCTGCAGACAGATGGCCCACATCTTCgtgtatggcaccctgaagcgcggccaacccaaccacaaagtcatgctggaccattcacatggcttagcagccttccgaggccgaggctgcacagttgagtccttcccactggtgattgcaggcgagcacaacataccttggctgctgtacctaccaggcaagggccactgtgtgacaggtgagatctacgaggtggacgagcagatgttgcgtttcctggatgactttgaagactgccccagcatgtaccagcgcacagccctgcaggtgcaggtgctagagtgggagggtgacggtgaccctggggacagtgtgcagtgctttgtgtacactacagccacctatgcacccgagtggctgtttcttccctaccatgaaagctatgattctgagggtccacatgggctacgctacaacccccgggaaaacagataaagggcTGTGCCCCAGACGCCAACAGGATGGAGGGAACCAGATAGCTTCCTGGCATAAGCAGAGCGTTCCAAGTTCAACTCTAAAGCATGCTGACAAAACATTTTTGTCATATACTCTAATCTGATGTGACTTAATACTGCTTTAGTCTTAAGGAGCACCTGGACTTGCAGGTACTAGATAGGAAACACTCTAGACTGAGGTCCCTGGTTCT

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCCCCGGGAAAACAGATAAA and ATGGCCCACATCTTCGTGTA. This resulted in a 440 bp internal deletion of Chr14:122,891,347-122,891,786 (GRCm38/mm10) that removes exon ENSMUSE00000332841.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
72997 CAG GTG AGA TCT ACG AGG T Wild type Forward A
72998 GTC ACC CTC CCA CTC TAG Wild type Reverse A
72999 Fluorophore-1 CGT TTC CTG GAT GAC TTT GA Quencher-1 WT Probe
73002 Fluorophore-2 CCT GGC ATA AGC AGA GCG TT Quencher-2 MUT Probe
73860 ATG GCC CAC ATC TTC TGT Mutant Forward A
73861 TCA GCA TGC TTT AGA GTT GA Mutant Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
72997 0.40 uM
72998 0.40 uM
73860 0.40 uM
73861 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.