For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 79 bp
Wild Type = 95 bp
>chr5:36485481+36485575 95bp ACCTACAGCAGAAGATTCAC CTCGGGAGATTCGGGTTC
Sequence
Large deletion: Mutant sequence with junction in uppercase
gagccgcgaggccccgccctaagcctgtcagccggcggggcgcggaccggaagtaggccgtgcgggccacgcctctcgggaaccagcgtccaattagcgcctcccttcacctgttcgcagatcttcattggcctaatattgccgggaggtggagagaaatggaaggcgggtgaccaatcgcggggcccaccgcgcgccctggttgccccgggaaacctaacagcaggcatcagccggcctcagagcggggccggcgggtcgaaaatggacAGccaaaactttcctcccctcttgacagcccttgacaggacagttggcaaaaacttctgcaaccccagaaactctcttactctcttctgcctctgattgtccattctgtggaacttgggggtgcaactttattttttggctgttttccagctttcaaattcctgctgaacacttccagctagcagtagctctacatgagcttaagaaaaatatatctagagagtgcggtgattaaactgacttctagtgaaaagcctttatagccaagtagccccagtctaaaggagtgttagaactgtctcttgcctatgtctaaggatggcttaaatgagtgggcaaggtacagaaaatctctatgcactgatctgatgactcaagtcatctttgt
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GAAAATGGACAGCCACTACG and AGGGGTGAAGCAAAAGATCA. This resulted in a 1,724 bp deletion of Chr5:36,484,659-36,486,382(GRCm38/mm10) that removes exon ENSMUSE00000346252.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73844 | ACC TAC AGC AGA AGA TTC AC | Wild type Forward | A | |||
| 73845 | CTC GGG AGA TTC GGG TTC | Wild type Reverse | A | |||
| 73846 | Fluorophore-1 | AGA CCC TAC GCA AGA AGG | Quencher-1 | WT Probe | ||
| 73847 | CTA ACA GCA GGC ATC AGC | Mutant Forward | A | |||
| 73848 | TCA AGA GGG GAG GAA AGT T | Mutant Reverse | A | |||
| 73849 | Fluorophore-2 | CGG GTC GAA AAT GGA CAG CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73844 | 0.40 uM |
| 73845 | 0.40 uM |
| 73847 | 0.40 uM |
| 73848 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.