For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 90 bp
Wild Type = 102 bp
>chr7:103812489+103812590 102bp TCCTTGCAAGAAACAAAAGT GGGGAAATGATGAAGACCTT
Sequence
Large deletion; Mutant sequence with junction in uppercase:
atagatagatacatagatagatacatagatagatagatagataaaagaaaagagtgatggatacttgaggcaagagaaattagactaaagtctctgagatactagacaacaagcagaaaatcaaggggcatttgtgaggaaaaattagaacaatacaaaaaactataaaacatagtatatgtctatgctgtaaattaaacccctatttaacttctttttctgagaaatggatgtcagggaaggttgctgacggaatagccacTAcagggtggctatggcccaggcttaagacatttgagttctgggtctcactctgagtagtgtctgttcttatccttgcagctaattctgtttctataacatcttctttaaatactgtatttttcaattcttgcaccaataacatagcttgtctgttcaatattatctcttcaatattgtttactacacaaataaaaaattaaaacacattatacataagaaaatttgcctgttctgtt
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATAAGTGGTGAGATAGTAAG and ATGACAACCATATCTACACA. This resulted in a 1,769 bp deletion of Chr7:103,812,287-103,814,055(GRCm38/mm10) that removes exons ENSMUSE00000633129 through ENSMUSE00000633127.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73833 | TCC TTG CAA GAA ACA AAA GT | Wild type Forward | A | |||
| 73834 | GGG GAA ATG ATG AAG ACC TT | Wild type Reverse | A | |||
| 73835 | Fluorophore-1 | ACA CAG AAT TGA GAT GAC AGT | Quencher-1 | WT Probe | ||
| 73837 | AAT GGA TGT CAG GGA AGG TT | Mutant Forward | A | |||
| 73838 | AGA GTG AGA CCC AGA ACT C | Mutant Reverse | A | |||
| 73839 | Fluorophore-2 | CAC TAC AGG GTG GCT ATG GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73833 | 0.40 uM |
| 73834 | 0.40 uM |
| 73837 | 0.40 uM |
| 73838 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.