For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 89 bp
Wild Type = 112 bp
>chr3:8947525-8947636 112bp CCTGTAGGTGGAAGAAGAAA CTTGAACTCCTGAAGCGA
Sequence
Wt Sequence (deletion in lower case):
GGACAGAGGCATAGGGGCAGAGGCATAGGGGCAGAGGCAGAGAGGCAGAGGGACAGAGGCAGAGGGGCAGAGGGACAGAGGCAGAGAGGCAGAGGCAGAGGCAGGTGGATCTCTGTGAATTTGAGGCCAACCTGGTCTACATAGAGAGTTCCATCCAGCCAAAGACGCATGGTGGGACTCTTTGCCTCAAATGAACAAACATACCACCCccagaggcgacgatagcatcagtgcatggcttgctttgatgtccttaataatttacagaaccgctctcactgtgtttcctcctcgaccctgctccctgtaggtggaagaagaaatccagactctgtcccaagtattggccgcaaaagagaagcatctcgccgagctcaagcggaagctcggcatctcctcgcttcaggagttcaagcagaacattgccaaagggtggcaagacgtgacggcaaccaatgcgtatgttcccccgattgtcacgcttctaggcggcAGAAAGGGCTTTGTCGTCTTGTCTTTGGGGAGAGGAGAAGGATGTTTCTGTGCTTTCTCTGTGGCCCACACAGCCTTTTCTTTCCAGTTCTTTCAAAGTACCCGACTCGTTTCTAATTTTGGTTTTCCAGAACATTCTAAGGAATAGAATCTCATGTACAGGTTGAGGGAACTGTTTTCAAGTTTGAAAAATGTT
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCGATTGTCACGCTTCTAGG and GATGCTATCGTCGCCTCTGG. This resulted in a 284 bp deletion of Chr3:8,947,447-8,947,730 (GRCm38/mm10) that removes exon ENSMUSE00000640154.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73813 | CCT GTA GGT GGA AGA AGA AA | Wild type Forward | A | |||
| 73814 | CTT GAA CTC CTG AAG CGA | Wild type Reverse | A | |||
| 73815 | Fluorophore-1 | CCA GAC TCT GTC CCA AGT AT | Quencher-1 | WT Probe | ||
| 73816 | CCT CAA ATG AAC AAA CAT ACC A | Mutant Forward | A | |||
| 73817 | CCA CAG AGA AAG CAC AGA A | Mutant Reverse | A | |||
| 73818 | Fluorophore-2 | CCA GAA AGG GCT TTG TCG TCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73813 | 0.40 uM |
| 73814 | 0.40 uM |
| 73816 | 0.40 uM |
| 73817 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.