For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 106 bp
Wild Type = 122 bp
>chr8:69864218+69864339 122bp TTTAAGTGATGCCCAGCCAT TCCTCTTCCTGAAACTGGAT
Sequence
Wt Sequence (deletion in lower case):
TGTCCCAGTGGGTCACTAGGTGTCTCTGATCCAATGTGGAAATAAAGAAACTGGAGGATGGCTTAGAGGTCAAGAGTGTTTCCTGGTCTTGCAAAGGACTGAGTTCAGTCCCCAGCACCTACACTGGGCAGCATACAGTTGCCTGTGAACCCAGCTCTAGGGGTCAGCCATGGACTTCCTGGACTCCCAGGGCACCTGCAGTCACACATGCACATGCCCACACACAGATGCGCACATAATTGATATTTTTAAGTGATGCCCAGCCATGGTGCCAGTGCCACTTGgtcctggctacttttctcttcagagagcacatcctggtctgcctctgttccctctagccgtgagcatccagtttcaggaagaggaccctcccgatgcccagctgctgaggttggataacatgctgctggctgagggtgtgtccaggccagagaagagaggccgaggagcagcagcaggcagcacagcaacaccaggtggctgtccaaatgacaatagcattgagcactcagactacagggccaagctgtcccagatccgacagatttaccactctgagctagagaagtatgaacaggtgatctttctacatgcaagagtttgtcttgtgaatgtgcactggccacagacagatgtggacatgagctccctgctctatggcagagcagggacagcccgccacagtcagtcactgcagaggggctggtgtcactgaaagcgctttcccctcactcctcagagctgacctgagtgtgagctgtgggggtggcagatgtggtcagctgtggagcccactgccccgcaccactggctgctgagtcacaggctggcccatcttttcccaccccaggcctgtcgtgagttcaccacacatgtcaccaaccttctccgggaacagagtagggtgaggcctgtgtcttgcagggagatggaacacatggtgaacaccatccagagcaagttcagtgccatccagaggcagctgaagcagagcacgtgtgaggctgtgatgactctacgctcacggttcctggatgccaggtcaggggctgcgtgccactggggtcccCGAGGGTTGGCCCTTAGATAATAGAAGCAGGATCAGAGTAGGATAGTTCCGATGTTTATGTCATAGTGTTGCAAGCGCTAATCCCATGTTCTCCCTACCACTGAGCCCAGCCAAGCTCTGTCTTGTTTTTAAGTCTGTCCAGAGGGTCTAGCCAAGGCCTCACATAGCTTCTTTATGAGAAGACCCAAAGTACAAACTGCTGGTTTGT
This mutation is a a 788 bp deletion of region Chr8:69,864,255-69,865,042 (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 71825 | TTT AAG TGA TGC CCA GCC AT | Common | A | |||
| 71826 | TCC TCT TCC TGA AAC TGG AT | Wild type Reverse | A | |||
| 71827 | ACA CTA TGA CAT AAA CAT CGG A | Mutant Reverse | A | |||
| 71828 | Fluorophore-1 | TCT TCA GAG AGC ACA TCC TG | Quencher-1 | WT Probe | ||
| 71829 | Fluorophore-2 | TGC CAC TTG CGA GGG TTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 71825 | 0.40 uM |
| 71826 | 0.40 uM |
| 71827 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.