For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:78904086+78904208 123bp AAGAACACACGGTACTAAGG GTAGGGATAGAAACACACCC
Mutant= 106 bp
Wild Type = 123 bp
Sequence
Wt Sequence (deletions in lower case):
GAATGAATGAATGAGTGGTGTTGGCTGAGAAATGAGTGAATGATGTTCCCAGAGAGAGTAAAGCAAGAATGAATGAAAGAATGACTGCATAGTGAGCAAGAACACACGGTACTAAGGATccgaggacccagcataaagacctggaagcctcaaatttaagaggccccctgtgggcggaccccaagtatagaccctggcctgggtgtgtttctatccctaccatctgttatcttctctgggggatccccagcctcatgtgtcccctccctactgtccctaaggacgagtacctggccgatctctaccacttctccaccaaggaggattcttatgccaactactttattcatgtgagtccactgcccagcctcagccacctgaaactcgggtggaagccacgaggaagcatctctggggacactggggaagtctccacttctctcacttctcctgggggatggctttgtccccacagctcttggagattcaggctgactaccaccgcaagtcactgacctcactcgacacggccctagctgagctgagggacaaccacagccaagcaggtagagacatgagtgaaccagcttcacactgctgaccctactaggctgaaagctctgtaaaAGTTGGCTCCTTAGCTGGGCAGAGTGGCAAACACCTTTAATCTGGGCAACCGGGTGGCAGAGGCAGGTGGATTTCTGAGTTTGAAGGCAGCCTAGTCTCCATAGAGAGTTC
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CACACGGTACTAAGGATCCG and GCTGAAAGCTCTGTAAAAGT. This resulted in a 508 bp internal deletion of Chr15:78,904,108-78,904,615 (GRCm38/mm10) that removes exons ENSMUSE00001261102 and ENSMUSE00001241677.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 72954 | Fluorophore-1 | ATA AAG ACC TGG AAG CCT CA | Quencher-1 | WT Probe | ||
| 72957 | GTA GGG ATA GAA ACA CAC CC | Wild type Reverse | A | |||
| 72958 | AAG AAC ACA CGG TAC TAA GG | Common | A | |||
| 72959 | Fluorophore-2 | TCC TTA GCT GGG CAG AGT GG | Quencher-2 | MUT Probe | ||
| 72960 | TCA AAC TCA GAA ATC CAC CT | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 72957 | 0.40 uM |
| 72958 | 0.40 uM |
| 72960 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.