For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:40988592+40988700 109bp GCATTGACTCTCCCATTTGA CCAGGCTGTTTCTTTCTACA
Mutant= 100 bp
Wild Type = 109 bp
Sequence
Wt Sequence (deletion in lower case):
AAAAATAGATTGTGTTCAGTAGTCAAAAATGTCATTTTCATCTTTTTCAGGGTATCTTGGCATTAAGTTTAACCTTGCTCAGTAGATTGTATGATAAATAGCATTACAGCCAGCTCTTTGTTTCAGAATGTACGATAacatgggtgttgtactgctgaaaaccatacttacgtttcacattgtctagctatctcataaaagttgagaatattggttaaaatgtatagcattgactctcccatttgatcttttgtaggcaaagtaaagaatcctgaatggagcagaaatgaaattccacatagttgtggtgaggtttgtagaaagaaacagcctggccaggactgtccacattcctgtaacctgtaagttggaaaaatagacttctggggagtctctgtggaagtgctttgctaatggctttaagtgtacatactgttgtcgcttaacaagAAGGGGGAAAGAGTGATATCAACCATTTGTTGAGCACTGAATCTCTAGCAGACACTCTACTAAGTACTTCAATTCTTCCCACAGCCTAGTGATGGATGCGTAGGTATGATCGTTTCCACTTCACAGATGAGGCTCATGCGCAGTGTTACTGTGCTAGGATATGATGGAGCTGGGTGTCAAAGCCAGTGATCCTTCTGTTG
This mutation is a a 313 bp deletion beginning at Chromosome 4 position 40,988,503 bp and ending after 40,988,815 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 71519 | GCA TTG ACT CTC CCA TTT GA | Wild type Forward | A | |||
| 71520 | CCA GGC TGT TTC TTT CTA CA | Wild type Reverse | A | |||
| 71522 | CCA GCT CTT TGT TTC AGA ATG | Mutant Forward | A | |||
| 71523 | TTG AAG TAC TTA GTA GAG TGT CT | Mutant Reverse | A | |||
| 72725 | Fluorophore-1 | ATG GAG CAG AAA TGA AAT TCC AC | Quencher-1 | WT Probe | ||
| 72726 | Fluorophore-2 | CAA CCA TTT GTT GAG CAC TGA ATC TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 71519 | 0.40 uM |
| 71520 | 0.40 uM |
| 71522 | 0.40 uM |
| 71523 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.