For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 115 bp
Wild Type =100 bp
>chr7:141650325-141650424 100bp ATACCATCACCCACTTTTCC TTGGGATGGATAGGTAACAC
Sequence
Large deletion: Mutant sequence with junction in uppercase
gcttaccagatcccttgcctgctgcctgcagccatgagccagtgcccagccaaccaagtgtaccaggagtgcggtgaggtctgcatcaagacttgctccaacccacagcacagctgctccagcccctgcaccttcggctgcttctgcccccacggtgaggatatataccatcacccacttttcccaaaactcatacccTCtgggggttgagtcaggagctgattggtagctaggcagttggaggacagggtttttgtctgtgggattctttgaggacatggactggctcccaagctgggaactacagccacatgtccctgtgcatgtggcctccccacccccaacacactggaaacattacgggaagggtggcttctctaggagtaaaac
This mutation is a 2,985 bp deletion of Chr7:141,647,405-141,650,389 (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 72720 | ATA CCA TCA CCC ACT TTT CC | Common | A | |||
| 72721 | TTG GGA TGG ATA GGT AAC AC | Wild type Reverse | A | |||
| 72722 | ATG TCC TCA AAG AAT CCC AC | Mutant Reverse | A | |||
| 72723 | Fluorophore-1 | AGC TTA GCC TAG ACA CCC | Quencher-1 | WT Probe | ||
| 72724 | Fluorophore-2 | AGC TAG GCA GTT GGA GGA CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 72720 | 0.40 uM |
| 72721 | 0.40 uM |
| 72722 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.