Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 103 bp
Wild Type = 109bp
>chr6:29158547-29158655 109bp CCGTAGTCCTGCTTGATAAA GCAAAGATCATATTGTCTAGGG
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
Large deletion: Mutant sequence with junction in uppercase
This mutation is a 447 bp deletion of Chr6:29,158,595-29,159,041 (GRCm38/mm10)
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 72618 | GCA AAG ATC ATA TTG TCT AGG G | Common | A | |||
| 72619 | CCG TAG TCC TGC TTG ATA AA | Wild type Reverse | A | |||
| 72620 | AGA TAC AAA GTA AGC TGT CAT C | Mutant Reverse | A | |||
| 72621 | Fluorophore-1 | TGG GAA AAG TCA CAT TAA TTT GT | Quencher-1 | WT Probe | ||
| 72622 | Fluorophore-2 | TCA CGA TTA GAA CAG CAA ACA ACT G | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 72618 | 0.40 uM |
| 72619 | 0.40 uM |
| 72620 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.