For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 66 bp
Wild Type = 99 bp
>chr11:74899215+74899313 99bp GATGGTCCTCCACATCAGGT CACCGTTCCCAAGTCTTCAT |
Sequence
Wt Sequence (deletions in lower case insertion in between ^^):
TGATTATTTTAAACAAAGGGTCTCACTGTGTAGCCCAGGCTGGCCTAGAACTCAGATCCTCCTACCTCTGCCTTCTGAGTGTTAAGTTAAAAGGCTTGGGCCACCACACCTGGCTCCTCTGATGTTTTCTTTTTTCTTTTCTTTTTTTTTTTTTTTGGGGGGGGGTGGTGGTGTTTCCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCCGGAACTCACTCTGTAGACCAGGCTGGCCTCAAACTCAGAAATGAGTGCTGGGATTAAAGGCGTGCGCCAGCTCCGCCCGGCCTGCTCTGATCTTTTCTAATGTTTTACGTTACATAAAATTACCTTGGTACTTTTACAAAGCAACAGAAAGGGGAGTAGTTctgccctggggttacagcacctgtatatttgaagatagaatagtgaagcaaatgattgaggtattcttggatctttgtgttgctaggttctggccgagaagaggcagctgggcagcaaggatggtcctccacatcaggtgctggtggtgcctctgcacagcaggatttcccttccagaggcatttaaactgcttcagaatgaagacttgggaacggtgtatttgagtgaacggggaagcacccagagttttatgcttctgtgccctagcttgaaacatcgatggtttttcacatatgcaagaccaggttagagtgtccgatacttttctctcattgtgtttaagtagttgtctctcttgaatatagtgtgctaactatcttttttttttttttatggtgtcttttgtatacaggggatctgcatactctgttagacatggctaaagtcgctgataccattctgttcctcctggacccactagaaggctgggacagtacgggggattattgcctgtcttgcctttttgctcagggccttcccacctatagtaagtgtgctgtattggataccagcaaagaaaacagctctggtctagtcatgcaggcacagtgtttaagattaagtttaggagtaaatcaatgggttgtattCTGCTGGTGTGGGCTA^aggtata^TACTTGGTAAACATTTTCATATATTTTACTCTTTTTATTTATTTATTTATTTGAGACAACAAGAGTTTCTTTTGGGCGGCCCTGACTATCCTAGAACT
This mutation is a 651 bp deletion beginning at Chromosome 11 position 74,899,096 bp and ending after 74,899,746 bp (GRCm38/mm10). There is a 7 bp insertion (TATACTT) 16 bp after the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67656 | GAT GGT CCT CCA CAT CAG GT | Wild type Forward | A | |||
| 67657 | CAC CGT TCC CAA GTC TTC AT | Wild type Reverse | A | |||
| 72600 | Fluorophore-1 | CCT CTG CAC AGC AGG ATT | Quencher-1 | WT Probe | ||
| 72601 | CCT TGG TAC TTT TAC AAA GCA | Mutant Forward | A | |||
| 72602 | AGT ATA TAC TTT AGC CCA CAC C | Mutant Reverse | A | |||
| 72603 | Fluorophore-2 | CAG AAA GGG GAG TAG TTC TGC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67656 | 0.40 uM |
| 67657 | 0.40 uM |
| 72601 | 0.40 uM |
| 72602 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.